論文

Embryonic stem (ES) cells are pluripotent cells derived from the inner cell mass of blastocysts. Transcription factor STAT3 is essential for the self-renewal of ES cells. In this study, we searched for downstream molecules of STAT3 in ES cells. Using DNA chip analysis, we obtained zinc finger protein (Zfp)-57. The expression of Zfp-57 was restricted to undifferentiated ES cells and activation of STAT3 led to expression of Zfp-57. We also found that forced expression of a dominant-negative mutant of STAT3 or repression of Oct-3/4 expression led to down-regulation of Zfp-57. Targeted disruption of Zfp-57 resulted in no gross phenotypical defects, including expression of undifferentiated-state-specific genes. These data suggest that Zfp-57 is a downstream molecule of STAT3 and Oct-3/4 in ES cells, although dispensable for their self-renewal. © 2005 Elsevier Inc. All rights reserved.

Summary: We have developed a program for microarray data analysis, which features the false discovery rate for testing statistical significance and the principal component analysis using the singular value decomposition method for detecting the global trends of gene-expression patterns. Additional features include analysis of variance with multiple methods for error variance adjustment, correction of cross-channel correlation for two-color microarrays, identification of genes specific to each cluster of tissue samples, biplot of tissues and corresponding tissue-specific genes, clustering of genes that are correlated with each principal component (PC), three-dimensional graphics based on virtual reality modeling language and sharing of PC between different experiments. The software also supports parameter adjustment, gene search and graphical output of results. The software is implemented as a web tool and thus the speed of analysis does not depend on the power of a client computer. © The Author 2005. Published by Oxford University Press. All rights reserved.

This article is based on a presentation at the First International Conference on Ethics, Science and Moral Philosophy of Assisted Human Reproduction. The goal is to provide scientific background for the discussion of philosophic issues. Recent advances in the systematic molecular analysis of preimplantation embryos are summarized, including the molecular identification of nearly all genes involved in preimplantation development and their detailed expression patterns. Notwithstanding a quantum leap in molecular understanding of preimplantation embryos, molecular evidence seems to provide no decisive definition of a threshold for the beginning of human life during preimplantation development. © 2005 Reproductive Healthcare Limited.

Loss of imprinting (LOI) of the insulin-like growth factor II gene (IGF2) is an epigenetic alteration that results in a modest increase in IGF2 expression, and it is present in the normal colonic mucosa of about 30% of patients with colorectal cancer. To investigate its role in intestinal tumorigenesis, we created a mouse model of Igf2 LOI by crossing female H19 +/- mice with male Apc+/Min mice. Mice with LOI developed twice as many intestinal tumors as did control littermates. Notably, these mice also showed a shift toward a less differentiated normal intestinal epithelium, reflected by an increase in crypt length and increased staining with progenitor cell markers. A similar shift in differentiation was seen in the normal colonic mucosa of humans with LOI. Thus, altered maturation of nonneoplastic tissue may be one mechanism by which epigenetic changes affect cancer risk.

To identify genes involved in morphogenetic events during mouse ovary development, we started with microarray analyses of whole organ RNA. Transcripts for 60% of the 15,000 gene NIA panel were detected, and about 2000 were differentially expressed in nascent newborn compared to adult ovary. Highly differentially expressed transcripts included noncoding RNAs and newly detected genes involved in transcription regulation and signal transduction. The phased pattern of newborn mouse ovary differentiation allowed us to (1) extend information on activity and stage specificity of cell type-specific genes; and (2) generate a list of candidate genes involved in primordial follicle formation, including podocalyxin (Podxl), PDGFR-β, and a follistatin-domain-encoding gene Flst1. Oocyte-specific transcripts included many (e.g., Deltex2, Bicd2, and Zfp37) enriched in growing oocytes, as well as a novel family of untranslated RNA's (RLTR10) that is selectively expressed in early stage follicles. The results indicate that global expression profiling of whole organ RNA provides sensitive first-line information about ovarian histogenesis for which no in vitro cell models are currently available.

Pre-implantation development is marked by many critical molecular events, including the maternal to zygotic transition and the first differentiation of cells. Understanding such events is important, for both basic reproductive biology and practical applications, including regenerative medicine and livestock production. Scarcity of materials has hampered the progress of the field, but systematic genomics approaches are beginning to be applied to the study of pre-implantation development, resulting in unprecedented amounts of data about the pre-implantation process. The first step in embryogenomics is to collect and sequence cDNAs (expressed sequence tags (ESTs)) for genes that are expressed and function in these early embryos. Mouse work is the most advanced, with 140 111 ESTs derived from all stages of pre-implantation development currently available in the public sequence database. For other mammals, at present only approximately 1000 ESTs can be found in the public database, but efforts by several groups are generating cDNA libraries and ESTs. In the present review, the current status of the implementation of these investigative tools for mammalian pre-implantation embryos is discussed.

We review age-related changes in the ovary and their effect on female fertility, with particular emphasis on follicle formation, follicle dynamics, and oocyte quality. The evidence indicates that the developmental processes leading to follicle formation set the rules determining follicle quiescence and growth. This regulatory system is maintained until menopause and is directly affected in at least some models of premature ovarian failure (POF), most strikingly in the Foxl2 mouse knockout, a model of human POF with monogenic etiology (blepharophimosis/ptosis/epicanthus inversus syndrome). Several lines of evidence indicate that if the ovarian germ cell lineage maintains regenerative potential, as recently suggested in the mouse, a role in follicle dynamics for germ stem cells, if any, is likely indirect or secondary. In addition, age-related variations in oocyte quality in animal models suggest that reproductive competence is acquired progressively and might depend on parallel growth and differentiation of follicle cells and stroma. Genomewide analyses of the mouse oocyte transcriptome have begun to be used to systematically investigate the mechanisms of reproductive competence that are altered with aging. Investigative and therapeutic strategies can benefit from considering the role of continuous interactions between follicle cells and oocytes from the beginning of histogenesis to full maturation. © 2004 New York Academy of Sciences.

The National Institutes of Health's Mammalian Gene Collection (MGC) project was designed to generate and sequence a publicly accessible cDNA resource containing a complete open reading frame (ORF) for every human and mouse gene. The project initially used a random strategy to select clones from a large number of cDNA libraries from diverse tissues. Candidate clones were chosen based on 5′-EST sequences, and then fully sequenced to high accuracy and analyzed by algorithms developed for this project. Currently, more than 11,000 human and 10,000 mouse genes are represented in MGC by at least one clone with a full ORF. The random selection approach is now reaching a saturation point, and a transition to protocols targeted at the missing transcripts is now required to complete the mouse and human collections. Comparison of the sequence of the MGC clones to reference genome sequences reveals that most cDNA clones are of very high sequence quality, although it is likely that some cDNAs may carry missense variants as a consequence of experimental artifact, such as PCR, cloning, or reverse transcriptase errors. Recently, a rat cDNA component was added to the project, and ongoing frog (Xenopus) and zebrafish (Danio) cDNA projects were expanded to take advantage of the high-throughput MGC pipeline. © 2004 by Cold Spring Harbor Laboratory Press.

Decreasing oocyte competence with maternal aging is a major factor in human infertility. To investigate the age-dependent molecular changes in a mouse model, we compared the expression profiles of metaphase II oocytes collected from 5- to 6-week-old mice with those collected from 42- to 45-week-old mice using the NIA 22K 60-mer oligo microarray. Among approximately 11 000 genes whose transcripts were detected in oocytes, about 5% (530) showed statistically significant expression changes, excluding the possibility of global decline in transcript abundance. Consistent with the generally accepted view of aging, the differentially expressed genes included ones involved in mitochondrial function and oxidative stress. However, the expression of other genes involved in chromatin structure, DNA methylation, genome stability and RNA helicases was also altered, suggesting the existence of additional mechanisms for aging. Among the transcripts decreased with aging, we identified and characterized a group of new oocyte-specific genes, members of the human NACHT, leucine-rich repeat and PYD-containing (NALP) gene family. These results have implications for aging research as well as for clinical ooplasmic donation to rejuvenate aging oocytes. © Oxford University Press 2004; all rights reserved.

Delayed implantation (embryonic diapause) occurs when the embryo at the blastocyst stage achieves a state of suspended animation. During this period, blastocyst growth is very slow, with minimal or no cell division. Nearly 100 mammals in seven different orders undergo delayed implantation, but the underlying molecular mechanisms that direct this process remain largely unknown. In mice, ovariectomy before preimplantation ovarian estrogen secretion on day 4 of pregnancy initiates blastocyst dormancy, which normally lasts for 1-2 weeks by continued progesterone treatment, although blastocyst survival decreases with time. An estrogen injection rapidly activates blastocysts and initiates their implantation in the progesterone-primed uterus. Using this model, here we show that among ≈20,000 genes examined, only 229 are differentially expressed between dormant and activated blastocysts. The major functional categories of altered genes include the cell cycle, cell signaling, and energy metabolic pathways, particularly highlighting the importance of heparin-binding epidermal growth factor-like signaling in blastocyst-uterine crosstalk in implantation. The results provide evidence that the two different physiological states of the blastocyst, dormancy and activation, are molecularly distinguishable in a global perspective and underscore the importance of specific molecular pathways in these processes. This study has identified candidate genes that provide a scope for in-depth analysis of their functions and an opportunity for examining their relevance to blastocyst dormancy and activation in numerous other species for which microarray analysis is not available or possible due to very limited availability of blastocysts.

Mouse Tabby (Ta) and X chromosome-linked human EDA share the features of hypoplastic hair, teeth, and eccrine sweat glands. We have cloned the T(a) gene and find it to be homologous to the EDA gene. The gene is altered in two Ta alleles with a point mutation or a deletion. The gene is expressed in developing teeth and epidermis; no expression is seen in corresponding tissues from Ta mice. Ta and EDA genes both encode alternatively spliced forms; novel exons now extend the 3' end of the EDA gene. All transcripts recovered have the same 5' exon. The longest Ta cDNA encodes a 391-residue transmembrane protein, ectodysplasin-A, containing 19 Gly-Xaa-Yaa repeats. The isoforms of ectodysplasin-A may correlate with differential roles during embryonic development.

The recently discovered second pseudoautosomal region (XqPAR) contains at least two genes, IL9R and SYBL1. Recent findings show that, like XpPAR genes, IL9R escapes X inactivation and its Y allele is also expressed, but SYBL1 seems to act like an X-linked gene, expressed from the active X chromosome but not from the inactive X or Y. Here we show that differences are also seen in the evolution of the sex chromosome locations of IL9R and SYBL1, IL9R is known to be autosomal in mice, and is X-linked only in primates. SYBL1, however, has been found to be on the X chromosome in all mammals tested, from marsupials to humans. Both genes were duplicated on the Y homologue of the terminal portion of the X chromosome during the evolution of Homo sapiens from other higher primates. The inactivation pattern of SYBL1 may be correlated with its longer history of X linkage, and at a more centromeric chromosomal position during evolution; the more recent X linkage and more telomeric position of the IL9R gene may explain its autosomal, 'uninactivated' transcriptional status.

Multiple familial trichoepithelioma (MFT) is an autosomal dominant skin disease characterized by the presence of many small tumors predominantly on the face. To map the causative gene, we performed linkage analysis with microsatellite markers in three American families. We found a significant linkage of a gene for MFT to chromosome 9p21. The maximum combined lod score was 3.31 at D9S171 at θ = 0. The disease locus was defined to a 4-cM region between IFNA and D9S126. Because several tumor suppressor genes including p16 and p15 have been mapped to this region, the gene for MFT may also be a tumor suppressor.

While constructing a catalog of mouse cDNAs which are expressed in the maternal-fetal interface during the peri-implantation period, we encountered a 1.6 kb cDNA clone showing a strong sequence similarity to the 3' untranslated region of the human dystroglycan gene. We cloned an additional 1.7 kb cDNA by reverse transcriptase-PCR (RT-PCR) and confirmed that this is a true mouse homolog of human dystroglycan cDNA by sequence analyses, Southern blotting, and genetic mapping of this gene on the distal region of mouse chromosome 9. Although it is well established that dystroglycan, a transmembrane protein, plays an important role in muscle tissues by bridging intracellular dystrophin to the laminin in the extracellular matrix, its role in non-muscle tissues remains elusive. To further investigate the role of the dystroglycan gene at the peri-implantation stage, we analyzed the expression patterns of this gene by in situ hybridization, which revealed that this gene is specifically expressed in decidual cells, especially in the cells surrounding the implantation site at 6.5, 7.5, and 8.5 day post conception (p.c.) stages, but not expressed in non-pregnant endometrial cells of uterus nor in the decidua at 12.5 day p.c. Further analyses by RT-PCR confirmed that the amount of dystroglycan mRNA in 8.5 day p.c. decidua was indeed 100-fold higher than that of non-pregnant uterus and 12.5 day p.c. mature placenta. These results suggest that dystroglycan may work as a mediator for adhesion between decidual cells themselves or between decidual cells and trophoblast cells, and provide a structural and functional support for maintaining pregnancy at its early stage.

Purpose. The aryl hydrocarbon receptor (AHR) mediates CYP1A1/1A2 induction by aryl hydrocarbons (e.g. TCDD). AHR proteins are similar to steroid receptors in their mechanism of action but constitute a distinct molecular family (1). In addition to a role in drug metabolism, it was suggested that AHR may regulate the homeostasis and cell differentiation (2). Two Drosophila proteins Sim and Per which are homologous to AHR appear to play roles in neural development and circadian rhythm, respectively. AHR may also have a function in mammalian retina. In this study, therefore, we investigated whether AHR mRNA is expressed in porcine retina. Methods. cDNA was synthesized from porcine retina RNA by RT-PCR using primers designed from mouse AHR cDNA and cloned into pCRTM II vector. DNA was sequenced with SP6 and T7 primers and analyzed by NCBI BLAST Search. Results. From a comparison of 341 bases, the porcine retina PCR product was found to be very similar to AHR from several species [rat (R), mouse (M), human (H), sheep (S)]. Hog: ACATAACGGACGAAATCCTGACCCGGTTGCAGAA R: -------A--------------GTACG-----G- (- , identical residue) M: -------G---------------TACG-----G-Hog: GTCATAGCTATTCTGTGTGAATGTATATACATTCACACAGAATAGCTATGAC H: ---------G------------------------------------------S: ------------------------------------------C---------Conclusions. AHR message is expressed in porcine retina. In the eye CYP1A1/1A2 induction is highest in the ciliary epithelium and negligible in the retina (3). Then, the question is: What is AHR doing in the retina?.

The polymerase chain reaction (PCR)-based method for screening pooled yeast artificial chromosome (YAC) libraries was modified by adding a step for the restriction enzyme digestion of the PCR products. This modification significantly increased the reliability of YAC screening and made it possible to identify YAC clones without a cumbersome verification step by colony hybridization and/or Southern blotting. Using this method, we assigned 39 mouse YAC clones to a mouse genetic map with 13 biallelic, polymorphic expressed sequence tags. This method provides a fast, reliable way to identify YAC clones with PCR-based sequence-tagged sites.